SGN Marker solcap_snp_sl_100917

SGN-M18457

Synonyms  
SGN-U584555_snp574
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54788)
Chromosome
8
Position
54.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAGCAGAACTTAGACACCGGGCAAGACTAGCTAGCAACAAGGAGGATTA
  
3' flanking region
CAAACATATTTTCTGCTCTGCTACGACTAAAGCATGGGGGGACGGGGAAT
SNP nucleotide
AG
SNPdb format
AAAGCAGAACTTAGACACCGGGCAAGACTAGCTAGCAACAAGGAGGATTA[A/G]
CAAACATATTTTCTGCTCTGCTACGACTAAAGCATGGGGGGACGGGGAAT
  
Genomic location of solcap_snp_sl_100917  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18457 marker 18457
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)