SGN Marker solcap_snp_sl_100921

SGN-M18461

Synonyms  
SGN-U584914_snp1830
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70476)
Chromosome
2
Position
50.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67004)
Chromosome
2
Position
70.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63479)
Chromosome
2
Position
99.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54792)
Chromosome
2
Position
41.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAGATATGGGTTTCTTTGATACTCAAGAAAATATCAGAGCATTGGTTGC
  
3' flanking region
ACTGCAGGCAATGTTCATGCCGCAGTAGAGAGACTTCTTGGAAATCTTGG
SNP nucleotide
TC
SNPdb format
CAAGATATGGGTTTCTTTGATACTCAAGAAAATATCAGAGCATTGGTTGC[T/C]
ACTGCAGGCAATGTTCATGCCGCAGTAGAGAGACTTCTTGGAAATCTTGG
  
Genomic location of solcap_snp_sl_100921  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18461 marker 18461
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)