SGN Marker solcap_snp_sl_100931

SGN-M18471

Synonyms  
SGN-U589380_snp40557
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67011)
Chromosome
9
Position
37.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63485)
Chromosome
9
Position
47.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54802)
Chromosome
9
Position
4.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATAGAGAAAAAAGAAATCATAAACACAGCCCATTTTCAGATCAATCAAAA
  
3' flanking region
TCTTGTAAATGACCCGTTAAAAGCGGCTACCTTGTTGTGTCATTTCTACC
SNP nucleotide
TC
SNPdb format
ATAGAGAAAAAAGAAATCATAAACACAGCCCATTTTCAGATCAATCAAAA[T/C]
TCTTGTAAATGACCCGTTAAAAGCGGCTACCTTGTTGTGTCATTTCTACC
  
Genomic location of solcap_snp_sl_100931  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18471 marker 18471
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)