SGN Marker solcap_snp_sl_100936

SGN-M18476

Synonyms  
SGN-U590370_snp65887
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70488)
Chromosome
2
Position
61.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67015)
Chromosome
2
Position
80.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63488)
Chromosome
2
Position
111.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54807)
Chromosome
2
Position
44.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAGGAAACTAAAGGAATTTAACCGTGTAAAGGAAAAAATTAAACACACT
  
3' flanking region
TATTTGGTGCTCTACCCCTCGTCTCTTCTTTTTGGCTTTCCCCGTACTCT
SNP nucleotide
AG
SNPdb format
AGAGGAAACTAAAGGAATTTAACCGTGTAAAGGAAAAAATTAAACACACT[A/G]
TATTTGGTGCTCTACCCCTCGTCTCTTCTTTTTGGCTTTCCCCGTACTCT
  
Genomic location of solcap_snp_sl_100936  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18476 marker 18476
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)