Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_100942

SGN-M18482

Synonyms  
SGN-U597311_snp612
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54813)
Chromosome
1
Position
84.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATGATTCATTGAAGAGCAATTTTATCACCACTCGAGTGTTCCATTGTTA
  
3' flanking region
TGTACCATTTAGTTTATTTGTACAGTTGACTCAATACAACAGTTTTGTAG
SNP nucleotide
AC
SNPdb format
CATGATTCATTGAAGAGCAATTTTATCACCACTCGAGTGTTCCATTGTTA[A/C]
TGTACCATTTAGTTTATTTGTACAGTTGACTCAATACAACAGTTTTGTAG
  
Genomic location of solcap_snp_sl_100942  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18482 marker 18482
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)