SGN Marker solcap_snp_sl_100944

SGN-M18484

Synonyms  
SGN-U599029_snp526
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70492)
Chromosome
7
Position
0.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67018)
Chromosome
7
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63490)
Chromosome
7
Position
0.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54815)
Chromosome
7
Position
0.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGTGTTATATGTGGGATTTAGGTATTACCAACAAAAAATGATGAAAGA
  
3' flanking region
GGATGGATAGATGAAGAAGAAATTACAAAATCAGAGGATTATTGGCAAGA
SNP nucleotide
AG
SNPdb format
TTTGTGTTATATGTGGGATTTAGGTATTACCAACAAAAAATGATGAAAGA[A/G]
GGATGGATAGATGAAGAAGAAATTACAAAATCAGAGGATTATTGGCAAGA
  
Genomic location of solcap_snp_sl_100944  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18484 marker 18484
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)