SGN Marker solcap_snp_sl_100945

SGN-M18485

Synonyms  
SGN-U600984_snp332
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70494)
Chromosome
2
Position
1.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67020)
Chromosome
2
Position
7.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63492)
Chromosome
2
Position
8.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54816)
Chromosome
2
Position
28.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGTTGCCCCAACTCCAGCAAATACTCCTCTTATGGATCTCCTCTCTACC
  
3' flanking region
ATGAATTGCTGCCACCTGTCACCGCATCTCCAGTGGAAGACAAGTTTGTC
SNP nucleotide
AG
SNPdb format
ATGTTGCCCCAACTCCAGCAAATACTCCTCTTATGGATCTCCTCTCTACC[A/G]
ATGAATTGCTGCCACCTGTCACCGCATCTCCAGTGGAAGACAAGTTTGTC
  
Genomic location of solcap_snp_sl_100945  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18485 marker 18485
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)