SGN Marker solcap_snp_sl_100946

SGN-M18486

Synonyms  
SGN-U601986_snp514
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70495)
Chromosome
11
Position
39.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54817)
Chromosome
11
Position
5.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTCTCAAGTGGTGTCTGCTATGGTTGGTGTTACTGATTTTAGTTATGA
  
3' flanking region
TATAACTATTAGATTTCAATTATGTTCATGTATAAAGAGGAATTTTCCTT
SNP nucleotide
AT
SNPdb format
GTTTCTCAAGTGGTGTCTGCTATGGTTGGTGTTACTGATTTTAGTTATGA[A/T]
TATAACTATTAGATTTCAATTATGTTCATGTATAAAGAGGAATTTTCCTT
  
Genomic location of solcap_snp_sl_100946  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18486 marker 18486
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)