SGN Marker solcap_snp_sl_100948

SGN-M18488

Synonyms  
SGN-U602949_snp105683
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67021)
Chromosome
2
Position
78.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63493)
Chromosome
2
Position
109.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54819)
Chromosome
2
Position
43.12 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCTGGTAACGAGGGGTTAATCTCACGGAGTATGACAGCTTAAGTTCGCA
  
3' flanking region
AACTATCAGAAAACCATAACCTCATCTCCAACATAAGCATAATCCTACCA
SNP nucleotide
CG
SNPdb format
TTCTGGTAACGAGGGGTTAATCTCACGGAGTATGACAGCTTAAGTTCGCA[C/G]
AACTATCAGAAAACCATAACCTCATCTCCAACATAAGCATAATCCTACCA
  
Genomic location of solcap_snp_sl_100948  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18488 marker 18488
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)