SGN Marker solcap_snp_sl_100955

SGN-M18495

Synonyms  
SGN-U604757_snp25016
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70502)
Chromosome
5
Position
14.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67025)
Chromosome
5
Position
18.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63496)
Chromosome
5
Position
21.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54826)
Chromosome
5
Position
2.14 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTTTCTAGTTTCAAGATTCTGAGTCGAAGGAACTGCTCATCGTTCACTT
  
3' flanking region
CCATACATTGGATCTAATGGTAACTTCTAGCAGCTTGAGTACCTCAAGAT
SNP nucleotide
TC
SNPdb format
ATTTTCTAGTTTCAAGATTCTGAGTCGAAGGAACTGCTCATCGTTCACTT[T/C]
CCATACATTGGATCTAATGGTAACTTCTAGCAGCTTGAGTACCTCAAGAT
  
Genomic location of solcap_snp_sl_100955  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18495 marker 18495
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)