SGN Marker solcap_snp_sl_100956

SGN-M18496

Synonyms  
SL1_00sc6004_1122406
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70556)
Chromosome
11
Position
76.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67058)
Chromosome
11
Position
80.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63524)
Chromosome
11
Position
95.93 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54827)
Chromosome
11
Position
51.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTCAGGCTTTGCAGCAAGATTGACAACAAGTAGAAGAGGTCATCACAAA
  
3' flanking region
ACTCGAGTTCGGATTCCAATGCAGTTAGCTCACTACAGAAGCCTGCAGAA
SNP nucleotide
TC
SNPdb format
GCTCAGGCTTTGCAGCAAGATTGACAACAAGTAGAAGAGGTCATCACAAA[T/C]
ACTCGAGTTCGGATTCCAATGCAGTTAGCTCACTACAGAAGCCTGCAGAA
  
Genomic location of solcap_snp_sl_100956  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18496 marker 18496
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)