SGN Marker T1235

SGN-M1854
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.05.03
Tomato EST read: TPTAD07TH
Arabidopsis best BAC match: AB013392.1
Arabidopsis position: 5.2360000
Arabidopsis identities: 0.750
Best GenBank protein hit: AAC04865.1
Evalue: 1.2e-36
Identities: 0.540
Description: IAA-amino acid hydrolase [Arabidopsis thaliana]
Comment: "ILR1, an amidohydrolase that releases active indole-3-acetic acid from conjugates"
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39554)
Chromosome
3
Position
160.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1235 was used as an overgo probe on plate 6 [well A11]

Plausible BAC Matches:   P334L01,   P004D04,   P001E24,   P251K18,   P207K20,   P334J19,   P327H20,   P266A19,   P251E14,   P206G15,   P306F07

 Non-Plausible BAC matches

P046C02,   P067O03,   P327B08,   P297E16,   P267A19,   P221O11

 Overgo Sequences

A sequence
TTGGGATTAGAGCGGATATGGACG
B sequence
TCCTGCATAGGAAGAGCGTCCATA
AB sequence
TTGGGATTAGAGCGGATATGGACGCTCTTC
Marker sequence
TTTAATTCAATACGTCTCCCATTTCAATTGGACCCTCTATCCATTTTCCC
CATATTTTCATCGTTTTCACCTAATCCAATGATGTACAGATTTCACTGTT
GAATTTGTTCCTTTCTTCATCTACTCCATTATTTTTCATTCACTCTTCTC
TTCCATCTGTGGGTTTCTTCCAACTTTTTTTTCTCATATGGATATCTCCA
GATGGGTTTTCTTGATTTTGATTTTTGTTTCTTTTGCCACAATACCCATA
TTCTCAGATTCTCAATTGAGTTCAGGAGAAATACCAGAAATACCGGGTAA
GTTTCTTGATTTTGCGAAGAAATCTGAGGTTTTTGATTGGATGGTGGAGG
TTAGGAGAAGGATTCAGTATAAATACCCTTTTGCGAATACTGGTATTGTT
GGCTTCATTGGTTCAGGAGACCCCCCTTTTGTTGGGATTAGAGCGGATAT
GGACGCTCTTCCTATGCAGGAAATGGTGGACTGGGAGCACAAAAGTAGAA
ATCCTGGTAAAATGCACGCATGTGGACATGATGCTCATATTGCAATGCTT
CTTGGTGCTGCAAAGATTCTTCTACAACATCAGAACATTTTGAAGGGAAC
AGTTGCTTTTG
Genomic location of T1235  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1854 marker 1854
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)