Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker solcap_snp_sl_101005

SGN-M18544

Synonyms  
CL009001-0343
SL10004_409_CL009001-0343
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70503)
Chromosome
9
Position
0.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67026)
Chromosome
9
Position
35.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63497)
Chromosome
9
Position
46.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54875)
Chromosome
9
Position
4.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTTGATATCTAAAAATTGGTTCCTTGCAATAATGAAATGCAATATTTTG
  
3' flanking region
CATTCAAGTGACCTGGAAACAGTAGTATACATATATGTGACATGATATAT
SNP nucleotide
AG
SNPdb format
ATTTGATATCTAAAAATTGGTTCCTTGCAATAATGAAATGCAATATTTTG[A/G]
CATTCAAGTGACCTGGAAACAGTAGTATACATATATGTGACATGATATAT
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43521)
Chromosome
9
Position
31.00 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43113)
Chromosome
9
Position
37.20 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
TTCCTTGCAATAATGAAATGCAATATTTTG
ASPE primers (5'-3')
TTTCCAGGTCACTTGAATGT
TTTCCAGGTCACTTGAATGC
3' flanking region
CATTCAAGTGACCTGGAAACAGTAGTATAC
SNP nucleotide
AG
SNPdb format
TTCCTTGCAATAATGAAATGCAATATTTTG[A/G]
CATTCAAGTGACCTGGAAACAGTAGTATAC
  
Genomic location of solcap_snp_sl_101005  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18544 marker 18544
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)