SGN Marker solcap_snp_sl_101014

SGN-M18553

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54884)
Chromosome
8
Position
61.31 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCATTTTTTT
  
3' flanking region
CTCAAGTGCAAGTCTGTAGTAAGTAGTAATTACTTTAGCATAATTGGTGG
SNP nucleotide
TC
SNPdb format
TTCATTTTTTT[T/C]
CTCAAGTGCAAGTCTGTAGTAAGTAGTAATTACTTTAGCATAATTGGTGG
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43528)
Chromosome
8
Position
56.90 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43122)
Chromosome
8
Position
73.70 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
ATAGAATCATAATTCCTGATTCATTTTTTT
ASPE primers (5'-3')
TACAGACTTGCACTTGAGG
TACAGACTTGCACTTGAGA
3' flanking region
CTCAAGTGCAAGTCTGTAGTAAGTAGTAAT
SNP nucleotide
CT
SNPdb format
ATAGAATCATAATTCCTGATTCATTTTTTT[C/T]
CTCAAGTGCAAGTCTGTAGTAAGTAGTAAT
  
Genomic location of solcap_snp_sl_101014  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18553 marker 18553
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)