SGN Marker solcap_snp_sl_101016

SGN-M18555

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54886)
Chromosome
10
Position
52.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACATAATGATACAGCTTAAAACAAACAATTTGCTTCGCATTGAGTCATAC
  
3' flanking region
TAGAGGTGATCAATTA
SNP nucleotide
AT
SNPdb format
ACATAATGATACAGCTTAAAACAAACAATTTGCTTCGCATTGAGTCATAC[A/T]
TAGAGGTGATCAATTA
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43532)
Chromosome
10
Position
31.90 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43127)
Chromosome
10
Position
32.40 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
ACATTTTTTCCTATTAATTGATCACCTCTA
ASPE primers (5'-3')
GCTTCGCATTGAGTCATACA
GCTTCGCATTGAGTCATACT
3' flanking region
GTATGACTCAATGCGAAGCAAATTGTTTGT
SNP nucleotide
AT
SNPdb format
ACATTTTTTCCTATTAATTGATCACCTCTA[A/T]
GTATGACTCAATGCGAAGCAAATTGTTTGT
  
Genomic location of solcap_snp_sl_101016  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18555 marker 18555
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)