SGN Marker T1238

SGN-M1856
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAD35TH
Arabidopsis best BAC match: AL035521.1
Arabidopsis position: 4.1750000
Arabidopsis identities: 0.600
Best GenBank protein hit: CAB80145.1
Evalue: 7.9e-26
Identities: 0.442
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49409)
Chromosome
2
Position
30.53 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47343)
Chromosome
2
Position
16.14 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39555)
Chromosome
2
Position
13.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1238 was used as an overgo probe on plate 10 [well D10]

Plausible BAC Matches:   P141H08,   P332B09,   P020I17,   P303I24

 Overgo Sequences

A sequence
AGAGGAGCACTCTAGTAGTTCCAC
B sequence
TCCTCGAGCTCATCAAGTGGAACT
AB sequence
AGAGGAGCACTCTAGTAGTTCCACTTGATG
Marker sequence
GCTGAATTCTTGCAAGCTACATGAGGTCCTGCCCAATACTGCTGTGTTAT
CTCAGTTTTATAAGGCCAGTATGCAGGAGAAATTTCAAAAGAGGAGCACT
CTAGTAGTTCCACTTGATGAGCTCGAGGATGATGACATGTTGCCTCTTGT
CGATATATTGCTTAATGTCCACCTTTACAATGTTGATGCGGTAGACATAC
TTTCCACGTCAAAATCGGTTGTGAATCAAGAATCTATCGTGTCTTTAATG
CGTGCAGTCAATTCAATACTCCGAAGGGTTGATCTTCAGGATACACTATT
AAGAAAGGACATCTTGTGGGATCTTTTTCAAGGTGGTTTGAATTGCCAAT
TGCTAAAGTTGAGGTCCACTGAGATTCAAAAGTTGAATATGGTTGGAAGC
TTCATGCAGTTACACACCCTTAATCTGGACTTTTGTTCTTCTCTCACTAG
CTTAGAGAAGGATTGCTTTACTTGCATGCCAAAATTGATGTGCCTCTCCA
TGTGTGGAACTAGAATAGCTGATCTGTGGACAACCCGTGAGGCTTTGTCT
CGGCTTCATTCTTTGACAGAACTAAGGTTTCAAAATTGCATATGTTGCAA
AGATACCTGGGCCATGTCTTGCATCATCCAATGGTGCA
Genomic location of T1238  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1856 marker 1856
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)