SGN Marker solcap_snp_sl_101026

SGN-M18565

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54896)
Chromosome
7
Position
62.41 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGCTTGAGAAAACATGGTCAATATTGGACCAGACCATGGTAATTTGTTT
  
3' flanking region
TGTTTGCTCTGGGCTTTGGCTAAAATACTTCGCAACATTGTGCTGACTGT
SNP nucleotide
AG
SNPdb format
TTGCTTGAGAAAACATGGTCAATATTGGACCAGACCATGGTAATTTGTTT[A/G]
TGTTTGCTCTGGGCTTTGGCTAAAATACTTCGCAACATTGTGCTGACTGT
  
Genomic location of solcap_snp_sl_101026  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18565 marker 18565
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)