SGN Marker solcap_snp_sl_101046

SGN-M18585

Synonyms  
CL009113-0189
SL10469_202_CL009113-0189
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70527)
Chromosome
5
Position
48.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67043)
Chromosome
5
Position
54.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63510)
Chromosome
5
Position
65.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54916)
Chromosome
5
Position
13.14 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTACACTCATCTTCTTTAGCATGACTTTTACATTCCCTTGAAAACGATA
  
3' flanking region
GATTACACAATCAGCATGAACATTCTGAAGATGCACCAGTTATGCAGTGT
SNP nucleotide
AC
SNPdb format
TCTACACTCATCTTCTTTAGCATGACTTTTACATTCCCTTGAAAACGATA[A/C]
GATTACACAATCAGCATGAACATTCTGAAGATGCACCAGTTATGCAGTGT
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43550)
Chromosome
5
Position
42.70 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43169)
Chromosome
5
Position
42.10 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
CATGACTTTTACATTCCCTTGAAAACGATA
ASPE primers (5'-3')
CATTCCCTTGAAAACGATAA
CATTCCCTTGAAAACGATAC
3' flanking region
GATTACACAATCAGCATGAACATTCTGAAG
SNP nucleotide
AC
SNPdb format
CATGACTTTTACATTCCCTTGAAAACGATA[A/C]
GATTACACAATCAGCATGAACATTCTGAAG
  
Genomic location of solcap_snp_sl_101046  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18585 marker 18585
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)