SGN Marker solcap_snp_sl_101053

SGN-M18592

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54923)
Chromosome
6
Position
35.20 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTTTTGTATCTTGTTCTCCGAGGTCATTTGCACCTTGACCCGAATATCT
  
3' flanking region
CATTTCTAATCATTGTCTTTCTATATATACTCACACATCCTCCTCAACAT
SNP nucleotide
AT
SNPdb format
CTTTTTGTATCTTGTTCTCCGAGGTCATTTGCACCTTGACCCGAATATCT[A/T]
CATTTCTAATCATTGTCTTTCTATATATACTCACACATCCTCCTCAACAT
  
Genomic location of solcap_snp_sl_101053  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18592 marker 18592
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)