SGN Marker solcap_snp_sl_101057

SGN-M18596

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54927)
Chromosome
10
Position
59.75 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTAAGATTTTTAACTTCACAAACAATAAATAGATTTTTTCTCCCATTAA
  
3' flanking region
CTGTGTGCTGTATGGACAAAGATTCTTAAACATGACCACAACCATTTTCC
SNP nucleotide
TC
SNPdb format
ATTAAGATTTTTAACTTCACAAACAATAAATAGATTTTTTCTCCCATTAA[T/C]
CTGTGTGCTGTATGGACAAAGATTCTTAAACATGACCACAACCATTTTCC
  

Map: Sun1642 x LA1589   
Map version
85 (location: 43751)
Chromosome
10
Position
53.30 cM
Confidence
uncalculated
Protocol
SNP


Sun1642 x LA1589

Assay data  
5' flanking region
AAACAATAAATAGATTTTTTCTCCCATTAA
ASPE primers (5'-3')
GTCCATACAGCACACAGG
GTCCATACAGCACACAGA
3' flanking region
CTGTGTGCTGTATGGACAAAGATTCTTAAA
SNP nucleotide
CT
SNPdb format
AAACAATAAATAGATTTTTTCTCCCATTAA[C/T]
CTGTGTGCTGTATGGACAAAGATTCTTAAA
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43189)
Chromosome
10
Position
43.90 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
AAACAATAAATAGATTTTTTCTCCCATTAA
ASPE primers (5'-3')
GTCCATACAGCACACAGG
GTCCATACAGCACACAGA
3' flanking region
CTGTGTGCTGTATGGACAAAGATTCTTAAA
SNP nucleotide
CT
SNPdb format
AAACAATAAATAGATTTTTTCTCCCATTAA[C/T]
CTGTGTGCTGTATGGACAAAGATTCTTAAA
  
Genomic location of solcap_snp_sl_101057  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18596 marker 18596
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)