SGN Marker CT234

SGN-M186

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT234 image not available
Forward sequence
ATACCACTACATAGAAGTAAGTCTCAAAGTTACAATAATAGCCACAAAGATGCTAATCTTCTAGCAAATGATGATTTTATTGAAGATGAG
CCTGTTCCCTTATCTCAAGTCAAGATAGGACAAGAATATGAAATTGTCCTCACTACTTTCACAGGTCTTTATCGGTATAGACTAGGGGAT
GTAGTAGAAGTTGCTGGTTTCCACAAGAAGACCCCCAAACTCAACTTTATATGCAGGAGAAAGCTGATATTAACAGTAAACATCGATAAG
AATACTGAACAGGACCTTCAGTTAGTGGTGGAGAGAGGTTCGCGAATACTAATAAGCAAGTCAAGAGCTGAGCTAGTAGACTTCACAAGC
CATGCAAATGTATCAAAAAGACCAGGTCATTATGTGATCTATTGGGAAATCAAAGGTGATGTTGATGAAAATGTTTTTGGAGAGTGTTGT
AGGGAGATGG
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1448103.8e-1748 (10.4% of RFLP seq)+
SGN-U1563014e-23204 (44.3% of RFLP seq)+
SGN-U144809460 (100.0% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53764)
Chromosome
10
Position
15.20 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A


Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53466)
Chromosome
10
Position
13.90 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51886)
Chromosome
10
Position
41.66 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49336)
Chromosome
10
Position
2.64 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47273)
Chromosome
10
Position
22.86 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43649)
Chromosome
10
Position
16.10 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43507)
Chromosome
10
Position
19.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43048)
Chromosome
10
Position
18.80 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Pepper Capsicum   
Map version
65 (location: 42700)
Chromosome
10
Position
33.70 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40752)
Chromosome
10
Position
11.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39029)
Chromosome
10
Position
22.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8486)
Chromosome
10
Position
13.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8487)
Chromosome
10
Position
20.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8491)
Chromosome
10
Position
25.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT234 was used as an overgo probe on plate 14 [well F1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCAAGTCAAGAGCTGAGCTAGTAG
B sequence
GCATGGCTTGTGAAGTCTACTAGC
AB sequence
GCAAGTCAAGAGCTGAGCTAGTAGACTTCA
Marker sequence
ATACCACTACATAGAAGTAAGTCTCAAAGTTACAATAATAGCCACAAAGA
TGCTAATCTTCTAGCAAATGATGATTTTATTGAAGATGAGCCTGTTCCCT
TATCTCAAGTCAAGATAGGACAAGAATATGAAATTGTCCTCACTACTTTC
ACAGGTCTTTATCGGTATAGACTAGGGGATGTAGTAGAAGTTGCTGGTTT
CCACAAGAAGACCCCCAAACTCAACTTTATATGCAGGAGAAAGCTGATAT
TAACAGTAAACATCGATAAGAATACTGAACAGGACCTTCAGTTAGTGGTG
GAGAGAGGTTCGCGAATACTAATAAGCAAGTCAAGAGCTGAGCTAGTAGA
CTTCACAAGCCATGCAAATGTATCAAAAAGACCAGGTCATTATGTGATCT
ATTGGGAAATCAAAGGTGATGTTGATGAAAATGTTTTTGGAGAGTGTTGT
AGGGAGATGG
Genomic location of CT234  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D186 marker 186
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)