SGN Marker solcap_snp_sl_101072

SGN-M18611

Synonyms  
CL009217-0735
SL10924_758_CL009217-0735
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54942)
Chromosome
2
Position
45.05 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTATATGTGTTCACTTTATGGTCTGGGAAACAAGTCGACTAACCGGCTTC
  
3' flanking region
AAATTGTAGGTTATACATCAAACAACCTCCATCTACCACTTCATGTTCTG
SNP nucleotide
AC
SNPdb format
TTATATGTGTTCACTTTATGGTCTGGGAAACAAGTCGACTAACCGGCTTC[A/C]
AAATTGTAGGTTATACATCAAACAACCTCCATCTACCACTTCATGTTCTG
  
Genomic location of solcap_snp_sl_101072  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18611 marker 18611
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)