SGN Marker solcap_snp_sl_101074

SGN-M18613

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54944)
Chromosome
1
Position
78.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTCTTGGTCTGGAAGTTCAAAGTCTTGGGGTTCTTGATTAAGTTTTCG
  
3' flanking region
AGGGTCTCGTTTGAATGTGTTCCTTTTCTAAGAAAGAAATAGGCATTTAA
SNP nucleotide
TC
SNPdb format
TTTTCTTGGTCTGGAAGTTCAAAGTCTTGGGGTTCTTGATTAAGTTTTCG[T/C]
AGGGTCTCGTTTGAATGTGTTCCTTTTCTAAGAAAGAAATAGGCATTTAA
  

Map: Sun1642 x LA1589   
Map version
85 (location: 43763)
Chromosome
1
Position
83.80 cM
Confidence
uncalculated
Protocol
SNP


Sun1642 x LA1589

Assay data  
5' flanking region
AAAGTCTTGGGGTTCTTGATTAAGTTTTCG
ASPE primers (5'-3')
CATTCAAACGAGACCCTG
CATTCAAACGAGACCCTA
3' flanking region
AGGGTCTCGTTTGAATGTGTTCCTTTTCTA
SNP nucleotide
CT
SNPdb format
AAAGTCTTGGGGTTCTTGATTAAGTTTTCG[C/T]
AGGGTCTCGTTTGAATGTGTTCCTTTTCTA
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43213)
Chromosome
1
Position
83.90 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
AAAGTCTTGGGGTTCTTGATTAAGTTTTCG
ASPE primers (5'-3')
CATTCAAACGAGACCCTG
CATTCAAACGAGACCCTA
3' flanking region
AGGGTCTCGTTTGAATGTGTTCCTTTTCTA
SNP nucleotide
CT
SNPdb format
AAAGTCTTGGGGTTCTTGATTAAGTTTTCG[C/T]
AGGGTCTCGTTTGAATGTGTTCCTTTTCTA
  
Genomic location of solcap_snp_sl_101074  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18613 marker 18613
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)