SGN Marker solcap_snp_sl_101077

SGN-M18616

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54947)
Chromosome
7
Position
39.15 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTTAAAGTAGACTTAGTTTTCAAAGTGCTTTCTCTTGTGTCGCTTTCT
  
3' flanking region
CGTTTAACTAACGGCAATTCATTTCCTGCCAACTCTAATTCTTTCAATAT
SNP nucleotide
TG
SNPdb format
TTTTTAAAGTAGACTTAGTTTTCAAAGTGCTTTCTCTTGTGTCGCTTTCT[T/G]
CGTTTAACTAACGGCAATTCATTTCCTGCCAACTCTAATTCTTTCAATAT
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43569)
Chromosome
7
Position
52.60 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43216)
Chromosome
7
Position
31.00 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
TTCAAAGTGCTTTCTCTTGTGTCGCTTTCT
ASPE primers (5'-3')
CTCTTGTGTCGCTTTCTG
CTCTTGTGTCGCTTTCTT
3' flanking region
CGTTTAACTAACGGCAATTCATTTCCTGCC
SNP nucleotide
GT
SNPdb format
TTCAAAGTGCTTTCTCTTGTGTCGCTTTCT[G/T]
CGTTTAACTAACGGCAATTCATTTCCTGCC
  
Genomic location of solcap_snp_sl_101077  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18616 marker 18616
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)