SGN Marker solcap_snp_sl_101079

SGN-M18618

Synonyms  
CL009238-0685
SL20017_699_CL009238-0685
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70636)
Chromosome
7
Position
3.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67112)
Chromosome
7
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63578)
Chromosome
7
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54949)
Chromosome
7
Position
0.78 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGGTTCATAGTATGACAAAAGCCACACACAAAGGCATGTCTCATAGAGA
  
3' flanking region
GCTGTTTAAAGGAAGAAAATAAAATCAGGAAAAAGAAAGAAAGATATATT
SNP nucleotide
AG
SNPdb format
CAGGTTCATAGTATGACAAAAGCCACACACAAAGGCATGTCTCATAGAGA[A/G]
GCTGTTTAAAGGAAGAAAATAAAATCAGGAAAAAGAAAGAAAGATATATT
  

Map: Sun1642 x LA1589   
Map version
85 (location: 43766)
Chromosome
7
Position
3.10 cM
Confidence
uncalculated
Protocol
SNP


Sun1642 x LA1589

Assay data  
5' flanking region
TCCTGATTTTATTTTCTTCCTTTAAACAGC
ASPE primers (5'-3')
AGGCATGTCTCATAGAGAG
AGGCATGTCTCATAGAGAA
3' flanking region
TCTCTATGAGACATGCCTTTGTGTGTGGCT
SNP nucleotide
CT
SNPdb format
TCCTGATTTTATTTTCTTCCTTTAAACAGC[C/T]
TCTCTATGAGACATGCCTTTGTGTGTGGCT
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43218)
Chromosome
7
Position
3.10 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
TCCTGATTTTATTTTCTTCCTTTAAACAGC
ASPE primers (5'-3')
AGGCATGTCTCATAGAGAG
AGGCATGTCTCATAGAGAA
3' flanking region
TCTCTATGAGACATGCCTTTGTGTGTGGCT
SNP nucleotide
CT
SNPdb format
TCCTGATTTTATTTTCTTCCTTTAAACAGC[C/T]
TCTCTATGAGACATGCCTTTGTGTGTGGCT
  
Genomic location of solcap_snp_sl_101079  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18618 marker 18618
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)