SGN Marker solcap_snp_sl_101080

SGN-M18619

Synonyms  
CL009239-0473
SL20023_486_CL009239-0473
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54950)
Chromosome
3
Position
58.62 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGGCTGCCCTTTCAAGATCAATGACGGTATGATACTTGGTAAAGAAGAC
  
3' flanking region
GCTTAGAAGAAAGCAGTCGTTACTTTATTTATCAGTTGATTGAAAATACC
SNP nucleotide
AT
SNPdb format
AAGGCTGCCCTTTCAAGATCAATGACGGTATGATACTTGGTAAAGAAGAC[A/T]
GCTTAGAAGAAAGCAGTCGTTACTTTATTTATCAGTTGATTGAAAATACC
  
Genomic location of solcap_snp_sl_101080  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18619 marker 18619
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)