SGN Marker solcap_snp_sl_10247

SGN-M18658

Synonyms  
CL016282-0291
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70659)
Chromosome
8
Position
72.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67128)
Chromosome
8
Position
70.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63594)
Chromosome
8
Position
110.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54989)
Chromosome
8
Position
61.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAATGAATATGATGGAGACTCATCCTTGGAGACCGCAACGCGGTCTCCC
  
3' flanking region
GAAAGATCAGTCTCCGTCCTCCGCGCGTGGCTCTTTGAACACTTTCTCCA
SNP nucleotide
AG
SNPdb format
CAAATGAATATGATGGAGACTCATCCTTGGAGACCGCAACGCGGTCTCCC[A/G]
GAAAGATCAGTCTCCGTCCTCCGCGCGTGGCTCTTTGAACACTTTCTCCA
  
Genomic location of solcap_snp_sl_10247  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18658 marker 18658
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)