SGN Marker solcap_snp_sl_10557

SGN-M18672

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70662)
Chromosome
2
Position
26.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67132)
Chromosome
2
Position
39.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55003)
Chromosome
2
Position
34.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACGGCATCCCTCTAAACAAAGAGAAATATGGCCCAACCTATTAATCTCAT
  
3' flanking region
TCAAGTTCAAACTAAGATTTTTAAGCAGTTGTAGCTGATTGGGCAGCCAT
SNP nucleotide
AC
SNPdb format
ACGGCATCCCTCTAAACAAAGAGAAATATGGCCCAACCTATTAATCTCAT[A/C]
TCAAGTTCAAACTAAGATTTTTAAGCAGTTGTAGCTGATTGGGCAGCCAT
  
Genomic location of solcap_snp_sl_10557  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18672 marker 18672
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)