SGN Marker solcap_snp_sl_10563

SGN-M18673

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70663)
Chromosome
2
Position
26.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67133)
Chromosome
2
Position
39.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55004)
Chromosome
2
Position
34.66 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAACCCCTTTTCTCGCGGTTAACACTTTCCGGTTTGGGTAGTTCAGACTT
  
3' flanking region
ACTGCTTTGAATTCGGGAGGCAATGGAAGGTGGAGAAGAGATTGAGATTG
SNP nucleotide
CG
SNPdb format
AAACCCCTTTTCTCGCGGTTAACACTTTCCGGTTTGGGTAGTTCAGACTT[C/G]
ACTGCTTTGAATTCGGGAGGCAATGGAAGGTGGAGAAGAGATTGAGATTG
  
Genomic location of solcap_snp_sl_10563  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18673 marker 18673
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)