SGN Marker T1255

SGN-M1869
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.05.03
Tomato EST read: TPTAE44TH
Arabidopsis best BAC match: AB010697.1
Arabidopsis position: 5.0120000
Arabidopsis identities: 0.684
Best GenBank protein hit: AAA53547.1
Evalue: 9.0e-84
Identities: 0.986
Description: polygalacturonase inhibitor protein[Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39558)
Chromosome
7
Position
82.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35600
Forward primer (5'-3')
TTTGCTTTGCTTCTCCTTCA
Digested band sizes (using AluI)
Solanum pennellii LA716: 350+220
Solanum lycopersicum LA925: 320+200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCAACTCGAGCAACGTCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 96
Forward primer (5'-3')
Unknown
Digested band sizes (using AluI)
Solanum pennellii LA716: 220+350
Solanum lycopersicum LA925: 200+320
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1255 was used as an overgo probe on plate 7 [well C10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCATGGGATCCAAACACAGATTGC
B sequence
CGACGTACCAGTAACAGCAATCTG
AB sequence
TCATGGGATCCAAACACAGATTGCTGTTAC
Marker sequence
GTTAAGTTATAATATAATATTGTTCATAAACAAAAAAACATGAATATGAA
TTTGCCTCTTCTTCTTGTAGTTATTTTTCTTTGCTTTGCTTCTCCTTCAC
TATCAGTAAGATGCAATCCAAAAGACAAAAAAGTCCTTCTACAAATAAAG
AAAGACTTAGGCAATCCTTACCATTTAGCTTCATGGGATCCAAACACAGA
TTGCTGTTACTGGTACGTCGTAAAATGTGACCGGAAAACCAACCGGATAA
ATGCCCTCACCGTCTTCCAAGCCAATATCTCCGGCCAAATTCCGGCAGCC
GTCGGAGACCTTCCATATCTCGAAACATTGGAATTCCATCATGTTACTAA
TCTCACTGGAACAATTCCACCTGCAATTGCTAAACTCACAAATCTCAAAA
TGTTAAGGCTCAGCTTCACTAACCTTACAGGTCCGATCCCTGAATNTCTT
AGTCAGCTGAAGAATTTGACGTTGCTCGAGTTGAATTACAATCAATTTAC
CGGAACAATCCCTTCTT
Genomic location of T1255  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1869 marker 1869
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)