Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_10904

SGN-M18695

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70677)
Chromosome
11
Position
50.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67143)
Chromosome
11
Position
51.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63600)
Chromosome
11
Position
62.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55026)
Chromosome
11
Position
45.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGCTCAAAACCTAGTCAGGAGAATTTGATTTTTCGAGTGTTGTTGTTCT
  
3' flanking region
TTTGTACCTTTTTCGATATACATGTAGCTTTGCCTAGTTCATCTGGTTGA
SNP nucleotide
CG
SNPdb format
AAGCTCAAAACCTAGTCAGGAGAATTTGATTTTTCGAGTGTTGTTGTTCT[C/G]
TTTGTACCTTTTTCGATATACATGTAGCTTTGCCTAGTTCATCTGGTTGA
  
Genomic location of solcap_snp_sl_10904  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18695 marker 18695
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)