SGN Marker TG408

SGN-M187

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTTGACTACTTCTAACATGTTGCAGGAGACACTTCACAAGCATAACAAAATAAAACAAGATAAAAATAACTTTCAAGAGGCTGTTGAAGG
ATCTCCAGATGAATCAAATGGATTAAATGTGTCTCAGAACATAAATCCTTCTGAACGCAGAGCCCCTAGCTCTCAAAAAAGCCTTCTGAT
GAATTGGCCCTTAATGTCTTCTATTATTGTCTACTGTGTATTCCAGCTCCACGATATAGCCTATTTGGAGGTAATGTATCTTTCTTTGAA
AAATCATTTTAATGGAAAAACGGGAAATCCAAGGAACCTTCTGGAGAATTGATCCTTAGCTTGAACAAACTTGTAAATATATCTTACTGT
CGTGTGCTTTTTCAGATATTTTCACTCTGGGCTGTTAGTCCAAGGACCCTTGGGGGTTTAAGCTTCACAACTTCTGATGTTGGACAAGTT
CTTGCC
Reverse sequence
GCCAATTGTCTTGAAAAGCGACATTGAGGACATTGAAATGCCATTTGCAGCTCCTCTTTGCTCCTGGGACTGAAGTTAAAACATTTTACT
CACACATGAACATTACTGATCACAGTTATATGGATAATAAGGAAAAAAAGTGCTTATGGTATAAGGTAGTTACCACAGCTCTATTCTGCA
TGATTAGTAAGCCAGTTGTAATTGATACCTGATCAAATATGAAAAATAACCACTTAGACCAAGCAAACAACTTCGAGATACTGAAACTGC
AAAAGCCAAACAAAGTTAATTGAGCAGATATATTATTCATAATTTTCATGTATAGGAAATAGGAGATATCATGAACCAGAAAATTAAGAT
ACAACTCATTTACATTCAACGAAGAACCTTAGATATTGAGTAACAAAGCATAAAGCTAACATAAACTTGAGAAAAGAGCTGCAAAGATGA
ATGAAGCAAAATATTATAGGTCATATATTTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53551)
Chromosome
10
Position
32.66 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53301)
Chromosome
10
Position
93.49 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50384)
Chromosome
10
Position
59.22 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48318)
Chromosome
10
Position
40.51 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper Capsicum   
Map version
65 (location: 42838)
Chromosome
10
Position
164.70 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40035)
Chromosome
10
Position
43.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8492)
Chromosome
10
Position
29.60 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXHIR 1997

Map: Pepper-FAO3   
Map version
31 (location: 8496)
Chromosome
10
Position
86.06 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8493)
Chromosome
10
Position
37.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8498)
Chromosome
10
Position
50.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG408 was used as an overgo probe on plate 14 [well F4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACGGGAAATCCAAGGAACCTTCTG
B sequence
CTAAGGATCAATTCTCCAGAAGGT
AB sequence
ACGGGAAATCCAAGGAACCTTCTGGAGAAT
Marker sequence
TTTGACTACTTCTAACATGTTGCAGGAGACACTTCACAAGCATAACAAAA
TAAAACAAGATAAAAATAACTTTCAAGAGGCTGTTGAAGGATCTCCAGAT
GAATCAAATGGATTAAATGTGTCTCAGAACATAAATCCTTCTGAACGCAG
AGCCCCTAGCTCTCAAAAAAGCCTTCTGATGAATTGGCCCTTAATGTCTT
CTATTATTGTCTACTGTGTATTCCAGCTCCACGATATAGCCTATTTGGAG
GTAATGTATCTTTCTTTGAAAAATCATTTTAATGGAAAAACGGGAAATCC
AAGGAACCTTCTGGAGAATTGATCCTTAGCTTGAACAAACTTGTAAATAT
ATCTTACTGTCGTGTGCTTTTTCAGATATTTTCACTCTGGGCTGTTAGTC
CAAGGACCCTTGGGGGTTTAAGCTTCACAACTTCTGATGTTGGACAAGTT
CTTGCC
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG408  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D187 marker 187
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)