SGN Marker T1256

SGN-M1870
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 30.04
Tomato EST read: TPTAE58TH
Arabidopsis best BAC match: AC004077.2
Arabidopsis position: 2.1910000
Arabidopsis identities: 0.842
Best GenBank protein hit: AAC26698.1
Evalue: 7.7e-57
Identities: 0.642
Description: putative katanin [Arabidopsis thaliana]
Comment: AAA ATPase invloved in microtubule disassembly.
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49411)
Chromosome
2
Position
34.75 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47345)
Chromosome
2
Position
46.27 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39559)
Chromosome
2
Position
40.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1256 was used as an overgo probe on plate 10 [well H5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTCCTCCTTTCGAGTCTGCAGAA
B sequence
CTGCTAAAGTGCGCATTTCTGCAG
AB sequence
CTTCCTCCTTTCGAGTCTGCAGAAATGCGC
Marker sequence
GCTCAACTTCTCTTCTCTCTCTCTACCGCAATTCAAATCGGAAGATCAGA
CAAATGGCCGACGAACCTGCGTTGACTCGATGGACCTTTCCGTTTGGGAG
GAGGAAGGTTCCTGCACGAGATGCAACTGAGAATGGTGATTCTGTGCAAA
ATGGAAATTCTTCAACTATGAATGGAAATGGATCTGTGCGGAACACTGCA
GAATTATCCATTTTCGAGCAGTATAATCAGGCTAATGGAGTTCAGTCTGC
CGGAGTGGATGGAAAACCGGAAAAATCTCTACTTCCTCCTTTCGAGTCTG
CAGAAATGCGCACTTTAGCAGAAAGCTTAACCAGGGATATTCTTCGTGGT
AATCCAGATGTTAAGTGGGAGAGCATTAAAGGATTAGAGACTGCCAAACG
TCTACTAAAAGAAGCAGTTGTCATGCCTATTAAATATCCAAAGTATTTTA
AAGGTCTTTTAACTCCTTGGAAAGGTATCCTCCTTTTTGGCCCTCCCGGA
ACAGGAAAGACCATGCTTGCGAAGGCAGTTGCAACTGAATGCAATACCAC
ATTTTTCAATATCTCAGCATCATCAGTTGTCAGCAAATGGCGTGGTGATT
CTG
Genomic location of T1256  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1870 marker 1870
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)