SGN Marker T1260

SGN-M1873
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAE80TH
Arabidopsis best BAC match: AC010797.2
Arabidopsis position: 3.0035000
Arabidopsis identities: 0.492
Best GenBank protein hit: AAF03451.1
Evalue: 1.2e-50
Identities: 0.492
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49413)
Chromosome
3
Position
54.18 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47347)
Chromosome
3
Position
64.32 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39561)
Chromosome
3
Position
78.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1260 was used as an overgo probe on plate 6 [well D9]

Plausible BAC Matches:   P203G17,   P013E02

 Overgo Sequences

A sequence
CAAAACTTGCTGCCTCGATATAGC
B sequence
ACTGAAGAGCTGAGACGCTATATC
AB sequence
CAAAACTTGCTGCCTCGATATAGCGTCTCA
Marker sequence
TTTGGATTTAGTGCAAGTCTTATTGTTTTCAACAGTCTGATAGATTCATA
CTGCAAAACTTGCTGCCTCGATATAGCGTCTCAGCTCTTCAGTGAAATGC
CAACTAAAGATTCAGTAAGCTTCAATGTGATGATAACAGGGTACACAAAA
TACGGTTTTCGTGAAGAAGCATTGAAACTTTTTATGCAAATGCGGAATAT
GGATTTTCAGCCTTCAGGTTTTACTTTTGCAGCAATGCTAGGTATGAGTG
TTGGATCAGAGGAAGTTATTTTTGGCCAGCAAATTCATGGACTTGCTATC
AAGACAAGCTATGTCTGGGACATATTTGTTGCAAATGCATTGCTTGATTT
CTACTCTAAGCATGACTATATAGATTTAGCAAAGAATCTCTTTGATGAGA
TGCCCGAGTTAGATGGTGTTTCGTATAACATAATTATCGCAGGTTATGCA
TGGAATGGGCAGTATGAGAAATTGTTTGATATCTTCAAAAGCCTACAGGG
TACATCATTTGACAGAAAGAATTTTCCTTTTGCCACAATATTGAGTGTAG
CTGCGGCGGAACTAAATTTAGCAATGGGAAGACAAACTCATGCACAGGCA
GTGGTGACAACAGCTATTTCAGAAGT
Genomic location of T1260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1873 marker 1873
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)