SGN Marker solcap_snp_sl_11084

SGN-M18748

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67161)
Chromosome
7
Position
7.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63618)
Chromosome
7
Position
11.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55079)
Chromosome
7
Position
3.46 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGTCGCTCCAAACTCTTCCCAGAAGGGTCACCAATTCGACCCGTAGCACC
  
3' flanking region
CCAATAAGCCCCACAGCATTATGCCCACAACGTAAAAACCAAGAAAGCAC
SNP nucleotide
TC
SNPdb format
GGTCGCTCCAAACTCTTCCCAGAAGGGTCACCAATTCGACCCGTAGCACC[T/C]
CCAATAAGCCCCACAGCATTATGCCCACAACGTAAAAACCAAGAAAGCAC
  
Genomic location of solcap_snp_sl_11084  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18748 marker 18748
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)