SGN Marker T1263

SGN-M1876
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAE91TH
Arabidopsis best BAC match: AF080121.1
Arabidopsis position: 5.0750000
Arabidopsis identities: 0.941
Best GenBank protein hit: BAB10022.1
Evalue: 7.0e-95
Identities: 0.940
Description: endosomal protein-like [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49414)
Chromosome
12
Position
3.44 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47348)
Chromosome
12
Position
44.57 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39563)
Chromosome
12
Position
45.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1263 was used as an overgo probe on plate 4 [well E3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTGCAGCTCTTCAAGACCAAGAG
B sequence
GCTAGATTGAGGAAGCCTCTTGGT
AB sequence
CTTGCAGCTCTTCAAGACCAAGAGGCTTCC
Marker sequence
GGTTTACTTGCAGCTCTTCAAGACCAAGAGGCTTCCTCAATCTAGCTTCA
CTGAAGAGAACAAATAATGTACAAACCAGAAAGACGAAAGGAACCCGACA
GTGCCTGTTGCAAACATAATAGCCAAGACCATGAAGAGGGAGTATCCGAG
GTAAAGGGTGGCGGAAACAGGGCCACTTAAGCTCTTGAGGTCGAATATTA
GATAGTTGATGGAGTACAGGAAAATGTATATCGCGACTGAACCAGAAGCA
AAGAATGACTTCCACCACCATTTCCAGTCCTCCACACAAAGATGCATGTA
GGTTAGAACAAGAGACACCTCAGCACAAACGACGACGAGGAGAATCATAA
CGATGAGGAGGAAACCGAAGACATAGTACACACGACCCATCCAGAGACTT
GACATGATAAAAAAGAGCTCAATGAACAGTGTGCCAAAAGGAAGGGTGCC
TGCCCCGAGAACCAAAAGCCAAGATGGATATTTCTGTGCTGGAATTTCAC
GTGGGATTTGGTTGGTTCGGACTGGGTATTCGATGTGAGGTGCCTTTGCC
CCAAGGTAGCCACCGATCANGGTTAGGGGGACGGAGATACAGAACC
Genomic location of T1263  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1876 marker 1876
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)