SGN Marker solcap_snp_sl_11281

SGN-M18762

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70723)
Chromosome
6
Position
8.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67166)
Chromosome
6
Position
10.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55093)
Chromosome
6
Position
28.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGGCGAAATTCCAGTAGACATTCAGGGTCTGAGTAATTTGAGAGCATTGA
  
3' flanking region
CTTGGGGAGAAATAAGTTCATGGGTGAAATTCCAGATGAAATTGGAGGTT
SNP nucleotide
AG
SNPdb format
CGGCGAAATTCCAGTAGACATTCAGGGTCTGAGTAATTTGAGAGCATTGA[A/G]
CTTGGGGAGAAATAAGTTCATGGGTGAAATTCCAGATGAAATTGGAGGTT
  
Genomic location of solcap_snp_sl_11281  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18762 marker 18762
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)