SGN Marker CT167

SGN-M188

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT167 image not available
Forward sequence
ATTAGCATTTGTGCTGGATTGTACTGTTGTTGTTGGCCTCCGTTGTTCATGTTCATTAGCATCGAGGCAGAGGAAGGATGATGATGACCA
CCGGTGGATAAAGATCCCGGTATAGCATTGTTTTGATGACCTTGAAATCCACCCGCGTTCAAGAATGCAGCAACGTTGTTGTTATTGTTA
GTAGTAGTAGTAGTAGTTCCATTGTTGTTATTCCCATGAAAACCAGCAAGATTCATCATTGAGTTTAAGTCGTTTCCTCCCACCATTCCA
ATTTTCGCAGCCTCGTTGAGGTTGACATTTGGACCTAATTGAGCAGCAGAAGCAGCACCATTCATGTTCATTTTCATAGCATGAATTGCT
CTTTGGTCAATGCCACCGCCTCCGGGATTTGCCTTCATTGGCATATTCGGACTAGGGCCAGTTTTCTTGCCATGAGCAGCAACATTGTTG
TTGTTACCTTTC
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1586644.1e-97178 (38.5% of RFLP seq)+
SGN-U1586645e-149265 (57.4% of RFLP seq)+
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132207)
Chromosome
10
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53452)
Chromosome
5
Position
24.26 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49321)
Chromosome
5
Position
2.67 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47259)
Chromosome
5
Position
34.52 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43639)
Chromosome
5
Position
11.30 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43500)
Chromosome
5
Position
15.40 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43039)
Chromosome
5
Position
14.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42307)
Chromosome
10
Position
11.90 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40742)
Chromosome
5
Position
12.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38988)
Chromosome
5
Position
30.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8499)
Chromosome
5
Position
35.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8501)
Chromosome
10
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8500)
Chromosome
5
Position
17.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8505)
Chromosome
5
Position
20.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT167 was used as an overgo probe on plate 5 [well B12]

Plausible BAC Matches:   P168M18,   P200E19

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCATTAGCATCGAGGCAGAGGAAG
B sequence
GGTGGTCATCATCATCCTTCCTCT
AB sequence
TCATTAGCATCGAGGCAGAGGAAGGATGAT
Marker sequence
ATTAGCATTTGTGCTGGATTGTACTGTTGTTGTTGGCCTCCGTTGTTCAT
GTTCATTAGCATCGAGGCAGAGGAAGGATGATGATGACCACCGGTGGATA
AAGATCCCGGTATAGCATTGTTTTGATGACCTTGAAATCCACCCGCGTTC
AAGAATGCAGCAACGTTGTTGTTATTGTTAGTAGTAGTAGTAGTAGTTCC
ATTGTTGTTATTCCCATGAAAACCAGCAAGATTCATCATTGAGTTTAAGT
CGTTTCCTCCCACCATTCCAATTTTCGCAGCCTCGTTGAGGTTGACATTT
GGACCTAATTGAGCAGCAGAAGCAGCACCATTCATGTTCATTTTCATAGC
ATGAATTGCTCTTTGGTCAATGCCACCGCCTCCGGGATTTGCCTTCATTG
GCATATTCGGACTAGGGCCAGTTTTCTTGCCATGAGCAGCAACATTGTTG
TTGTTACCTTTC
Genomic location of CT167  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D188 marker 188
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)