Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker T1267

SGN-M1880
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.10
Tomato EST read: TPTAF10TH
Arabidopsis best BAC match: AC006569.4
Arabidopsis position: 2.1170000
Arabidopsis identities: 0.862
Best GenBank protein hit: AAD21754.1
Evalue: 6.7e-76
Identities: 0.782
Description: putative tyrosine decarboxylase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49416)
Chromosome
9
Position
57.25 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47350)
Chromosome
9
Position
53.11 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39565)
Chromosome
9
Position
51.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1267 was used as an overgo probe on plate 6 [well C3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAACTTTCGGGTGCTGAAAGCAG
B sequence
TAATCCCTGGATGGGTCTGCTTTC
AB sequence
AGAACTTTCGGGTGCTGAAAGCAGACCCAT
Marker sequence
CAAACTCATTCTTCTTTACAGAAAGCTTGCCAGATCGGAGGAATTTATCC
TGAGAACTTTCGGGTGCTGAAAGCAGACCCATCCAGGGATTATGCTCTTT
CTCCTGATACACTTTCAGAAGCTGTATCACATGACATGGCCACTGGTTTA
ATACCTTTCTTCTTTTGTGCTACTATTGGTACAACATCTTCAACTGCTGT
GGATCCTTTGCTCGAACTGGGAAAGATTGCCAAGAGTAATAGCATATGGT
TTCATGTGGATGCGGCCTATGCTGGAAGTGCATGTATCTGTCCAGAATAC
CGGGGCTATATGAATGGTGTCGAAGAAGCTGATTCGTTCAACATGAATGC
ACATAAGTGGTTTCTGACAAACTTTGACTGTTCCGCTCTCTGGGTCAAGG
ACCGGAGTGCACTCATCCAGTCACTGTCAACAAATCCTGAGTATCTCAAA
AACAAAGCCTCTCAAGAAAACTTGGTTGTGGATTACAAAGATTGGCAAAT
TCCTCTTGGAC
Genomic location of T1267  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1880 marker 1880
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)