SGN Marker solcap_snp_sl_11736

SGN-M18802

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70751)
Chromosome
9
Position
69.65 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67183)
Chromosome
9
Position
83.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55133)
Chromosome
9
Position
66.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCACCTGTGTTTCAGTTGTTGCAATACTTATGTCAATTGTGCTGATATA
  
3' flanking region
AGTTGTAATGCACCTAGTGCGTAGAATTTTATGCAATGGCAAAGGCAGGG
SNP nucleotide
AG
SNPdb format
ATCACCTGTGTTTCAGTTGTTGCAATACTTATGTCAATTGTGCTGATATA[A/G]
AGTTGTAATGCACCTAGTGCGTAGAATTTTATGCAATGGCAAAGGCAGGG
  
Genomic location of solcap_snp_sl_11736  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18802 marker 18802
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)