SGN Marker solcap_snp_sl_11752

SGN-M18805

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70753)
Chromosome
9
Position
71.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67185)
Chromosome
9
Position
87.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55136)
Chromosome
9
Position
66.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTTGCTCACTTGTCTATACAAGCATAGCAAATTTCGTAGGTAGGAGAT
  
3' flanking region
GAACGTAACGCGATTTTGTGTTGAACGAATTTTCCTTAGCTTTTAATGTA
SNP nucleotide
AG
SNPdb format
TCTTTGCTCACTTGTCTATACAAGCATAGCAAATTTCGTAGGTAGGAGAT[A/G]
GAACGTAACGCGATTTTGTGTTGAACGAATTTTCCTTAGCTTTTAATGTA
  
Genomic location of solcap_snp_sl_11752  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18805 marker 18805
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)