Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_11982

SGN-M18817

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63640)
Chromosome
7
Position
108.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55148)
Chromosome
7
Position
64.76 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTACAACTTGAGAATTTAGGCAAAACGATTACAGATTTTATGTAGAAAG
  
3' flanking region
GTTGAACCAAAGGAGAGAAGAGATAATTGGAGGTTGGTGTACACTGTACA
SNP nucleotide
AT
SNPdb format
TCTACAACTTGAGAATTTAGGCAAAACGATTACAGATTTTATGTAGAAAG[A/T]
GTTGAACCAAAGGAGAGAAGAGATAATTGGAGGTTGGTGTACACTGTACA
  
Genomic location of solcap_snp_sl_11982  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18817 marker 18817
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)