SGN Marker solcap_snp_sl_12147

SGN-M18826

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70764)
Chromosome
7
Position
68.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55157)
Chromosome
7
Position
62.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAGTTCTAAAGAATCTATTCACAGGCCAATTTAGTGCCAAAACTGGTCA
  
3' flanking region
GCAAATTGCAAACGCTTGGAAAGCAGACAAAGGCTTCCTGTAGTCCATTG
SNP nucleotide
TG
SNPdb format
CAAGTTCTAAAGAATCTATTCACAGGCCAATTTAGTGCCAAAACTGGTCA[T/G]
GCAAATTGCAAACGCTTGGAAAGCAGACAAAGGCTTCCTGTAGTCCATTG
  
Genomic location of solcap_snp_sl_12147  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18826 marker 18826
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)