Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_12150

SGN-M18829

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70766)
Chromosome
7
Position
68.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67192)
Chromosome
7
Position
52.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63645)
Chromosome
7
Position
71.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55160)
Chromosome
7
Position
62.30 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGACTAGTTTCTCTCGAAGAAACATAAGTTCTGATTCTTTGAGTTTGAG
  
3' flanking region
TGTGAATCCAGCTTCTTTCCCATGATATCATACGTCTTCAAGACACTCTT
SNP nucleotide
TC
SNPdb format
TCGACTAGTTTCTCTCGAAGAAACATAAGTTCTGATTCTTTGAGTTTGAG[T/C]
TGTGAATCCAGCTTCTTTCCCATGATATCATACGTCTTCAAGACACTCTT
  
Genomic location of solcap_snp_sl_12150  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18829 marker 18829
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)