SGN Marker solcap_snp_sl_12185

SGN-M18838

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67196)
Chromosome
5
Position
60.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55169)
Chromosome
5
Position
60.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCACAATCGAAAGAGCAATCGCTGAAACTCATGAGTTTTCGAGGAAGATT
  
3' flanking region
GTTCGAAGAGATTTGTAAAGACTGCTATGAATAATTTCTCTGTTTAGATC
SNP nucleotide
AT
SNPdb format
GCACAATCGAAAGAGCAATCGCTGAAACTCATGAGTTTTCGAGGAAGATT[A/T]
GTTCGAAGAGATTTGTAAAGACTGCTATGAATAATTTCTCTGTTTAGATC
  
Genomic location of solcap_snp_sl_12185  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18838 marker 18838
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)