SGN Marker solcap_snp_sl_12233

SGN-M18856

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70780)
Chromosome
5
Position
70.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67204)
Chromosome
5
Position
72.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63658)
Chromosome
5
Position
117.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55187)
Chromosome
5
Position
62.20 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GACGATCAGCTACCGAATTCAGTAATTTACGTTAGTTTTGGGAGTATCGC
  
3' flanking region
ACAATGACGAATGATCAATTGATTGAATTTTGGTACGGATTGGTTAACAG
SNP nucleotide
CG
SNPdb format
GACGATCAGCTACCGAATTCAGTAATTTACGTTAGTTTTGGGAGTATCGC[C/G]
ACAATGACGAATGATCAATTGATTGAATTTTGGTACGGATTGGTTAACAG
  
Genomic location of solcap_snp_sl_12233  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18856 marker 18856
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)