SGN Marker solcap_snp_sl_12244

SGN-M18866

Synonyms  
Le009956_38
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67205)
Chromosome
5
Position
72.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63659)
Chromosome
5
Position
118.83 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55197)
Chromosome
5
Position
62.31 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGGGCTAGCTTGGAACCCACATGATCAAGGTAATAGTCTCTCTCAGGAC
  
3' flanking region
CGAGTTGTATCGCGGAGCCCAAGGTTGTGGAGGACCTTGTAGCCTTTCAT
SNP nucleotide
TC
SNPdb format
TCGGGCTAGCTTGGAACCCACATGATCAAGGTAATAGTCTCTCTCAGGAC[T/C]
CGAGTTGTATCGCGGAGCCCAAGGTTGTGGAGGACCTTGTAGCCTTTCAT
  
Genomic location of solcap_snp_sl_12244  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18866 marker 18866
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)