Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_12260

SGN-M18878

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70786)
Chromosome
5
Position
72.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67210)
Chromosome
5
Position
73.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63663)
Chromosome
5
Position
120.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55209)
Chromosome
5
Position
62.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCAGACACATTGTCATCTGTCCGTCTTCTTACATATTCAACTCCGTCCG
  
3' flanking region
CCAGTATGAACTTTTATTGTCGCCTATTGAGCAAAGTGCATCTCCTACAC
SNP nucleotide
TG
SNPdb format
ATCAGACACATTGTCATCTGTCCGTCTTCTTACATATTCAACTCCGTCCG[T/G]
CCAGTATGAACTTTTATTGTCGCCTATTGAGCAAAGTGCATCTCCTACAC
  
Genomic location of solcap_snp_sl_12260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18878 marker 18878
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)