SGN Marker solcap_snp_sl_12263

SGN-M18881

Synonyms  
CL017628-0188
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55212)
Chromosome
5
Position
62.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATTGGTCGAAGCCAAGCTGTTCAACAAACAACTCGTTCAGATCTTGGTG
  
3' flanking region
TGCTACCATCAATCCATCAACTTATGGTGAACTGGAAAATCCTTCTGCTG
SNP nucleotide
CG
SNPdb format
GATTGGTCGAAGCCAAGCTGTTCAACAAACAACTCGTTCAGATCTTGGTG[C/G]
TGCTACCATCAATCCATCAACTTATGGTGAACTGGAAAATCCTTCTGCTG
  
Genomic location of solcap_snp_sl_12263  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18881 marker 18881
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)