SGN Marker solcap_snp_sl_12277

SGN-M18890

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70793)
Chromosome
5
Position
72.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67218)
Chromosome
5
Position
74.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63671)
Chromosome
5
Position
120.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55221)
Chromosome
5
Position
62.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTTAATGAGAGGTGTACCTGCCATTCTGGAAAAACTATTAGGATGTGCC
  
3' flanking region
TAAACAAGGCAAGTTTCACAAAACATCTACAAATCCTTGATGCTAATTAC
SNP nucleotide
TG
SNPdb format
CTTTAATGAGAGGTGTACCTGCCATTCTGGAAAAACTATTAGGATGTGCC[T/G]
TAAACAAGGCAAGTTTCACAAAACATCTACAAATCCTTGATGCTAATTAC
  
Genomic location of solcap_snp_sl_12277  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18890 marker 18890
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)